Input boxes for DNA upstream sequences
Paste or upload your DNA cluster sequences here. Please note, sequences must be in FASTA format. Maximum cluster size is 62,000 characters. If you wish to input two clusters, you must click the button below the text areas to enable this.
For example:
>GeneID information, header information etc
TTCAGCTAGCTGCTACGATCGTACGTA
TAACACACATGCAT

Patterns to search for
Enter a list of patterns to be clustered into the text box. Patterns you wish to search for must only contain IUPAC letters.

Sequence length
This parameter defines the length of the sequences used in the program. Please note, that longer input sequences are cut to contain only the wanted number of bases and smaller sequences are treated as such.



This tool was developed by Matti Kankainen, University of Helsinki
Contact the Webmaster.
© 2006 University of Helsinki